| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.148823 |
| Chromosome: | chromosome 12 |
| Location: | 2001681 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510300 | UBC21 | E2 Ubiquitin conjugating enzyme; (1 of 1) PF00179//PF10408 - Ubiquitin-conjugating enzyme (UQ_con) // Ubiquitin elongating factor core (Ufd2P_core) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACATGCTCCGTCTCAGCGTGGTCTTGCA |
| Internal bar code: | TGGGCACGAGGAACCAGTAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 138 |
| LEAP-Seq percent confirming: | 98.3318 |
| LEAP-Seq n confirming: | 1061 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCCTCCCCGTCTACCACT |
| Suggested primer 2: | GAGGAGTGTCTCTCAACCGC |