| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.148926 |
| Chromosome: | chromosome 2 |
| Location: | 2509023 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092200 | QAD1 | (1 of 8) IPR011047//IPR018391 - Quinonprotein alcohol dehydrogenase-like superfamily // Pyrrolo-quinoline quinone beta-propeller repeat; Quinonprotein alcohol dehydrogenase-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCAGGGACGCACCTCAGAGGCCGCTCT |
| Internal bar code: | ACGTGGAGTAAACGGCGCAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 108 |
| LEAP-Seq percent confirming: | 68.9873 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGACTTCTTTAGCTCGGTG |
| Suggested primer 2: | GGTCTCCGTTGTTGTCCAGT |