| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.148982 |
| Chromosome: | chromosome 13 |
| Location: | 632197 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g565900 | (1 of 2) PF10513 - Enhancer of polycomb-like (EPL1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCGCTGCACTTGTCAAACCAGCCTACGT |
| Internal bar code: | ACATATAACACTCCATCGTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 456 |
| LEAP-Seq percent confirming: | 99.9335 |
| LEAP-Seq n confirming: | 1502 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGGCTAGATGAAGGGAT |
| Suggested primer 2: | GCTGGCAGATTGAAGGGATA |