| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149005 |
| Chromosome: | chromosome 6 |
| Location: | 928380 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g255300 | CGLD28 | Conserved in the Green Lineage and Diatoms; (1 of 1) IPR000104//IPR025461 - Antifreeze protein, type I // Protein of unknown function DUF4281 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCGGCATCCAAGCTGGTGAGAGGTGAT |
| Internal bar code: | GATGGCACTCTGTCGTCGGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 740 |
| LEAP-Seq percent confirming: | 90.4239 |
| LEAP-Seq n confirming: | 576 |
| LEAP-Seq n nonconfirming: | 61 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCGCCAAGCAGGAAATAG |
| Suggested primer 2: | GCCATGACTACATCCAGGGT |