| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149123 |
| Chromosome: | chromosome 14 |
| Location: | 4059674 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633700 | (1 of 6) 3.4.19.12//3.4.22.69 - Ubiquitinyl hydrolase 1 / Ubiquitin thiolesterase // SARS coronavirus main proteinase / Severe acute respiratory syndrome coronavirus main protease | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGGAGGGAAAGGCGGCGGGGAGGGAGG |
| Internal bar code: | GGGACGGCCGGTAGACCTGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 579 |
| LEAP-Seq percent confirming: | 67.46 |
| LEAP-Seq n confirming: | 1729 |
| LEAP-Seq n nonconfirming: | 834 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAGGTGTGCGTGTATGTG |
| Suggested primer 2: | ACCAAGCTGGCTGTATGTCC |