| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.149125 |
| Chromosome: | chromosome 3 |
| Location: | 2286548 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158100 | SMM9 | (1 of 1) IPR026170//IPR029063 - FAM173 family // S-adenosyl-L-methionine-dependent methyltransferase; S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGCCCCCGCTTGTCGGGCTGTCCCTTC |
| Internal bar code: | GGACAGAAGGGTGTACCGACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2383 |
| LEAP-Seq percent confirming: | 4.34783 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCAGCACATATACGGTGT |
| Suggested primer 2: | AATGGGGGCATCAAACAATA |