| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149153 |
| Chromosome: | chromosome 12 |
| Location: | 3339459 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g497500 | SNE7 | (1 of 8) PTHR10366:SF411 - HIGH CHLOROPHYLL FLUORESCENCE PHENOTYPE 173 PROTEIN; Cinnamoyl-CoA reductase/flavanone 4-reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCCACCAAACCCTTTTCCTGTGCGCAT |
| Internal bar code: | ATGGACGATTGGGGTTGATGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 975 |
| LEAP-Seq percent confirming: | 86.9518 |
| LEAP-Seq n confirming: | 1586 |
| LEAP-Seq n nonconfirming: | 238 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGACCGGGTTACCAGTTA |
| Suggested primer 2: | GCCGCTTCTACTGGTACTGC |