| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.149199 |
| Chromosome: | chromosome 12 |
| Location: | 8282874 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g550152 | (1 of 1) PF12253 - Chromatin assembly factor 1 subunit A (CAF1A) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGGCGACGAGGCAGACAGCCAGGCGGGC |
| Internal bar code: | GGGGTCATGTTGGGTCGCTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 277 |
| LEAP-Seq percent confirming: | 99.84 |
| LEAP-Seq n confirming: | 3744 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGCAGCAACATCAGAAC |
| Suggested primer 2: | CCTACTACGGCTCGTTCAGC |