| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149285 |
| Chromosome: | chromosome 12 |
| Location: | 8345990 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549400 | (1 of 4) PF09366 - Protein of unknown function (DUF1997) (DUF1997) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTCCGTGTGGGCGACCCGCGCTTCGACG |
| Internal bar code: | CCTCGGGGCTATTTCGGTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 940 |
| LEAP-Seq percent confirming: | 90.1987 |
| LEAP-Seq n confirming: | 6037 |
| LEAP-Seq n nonconfirming: | 656 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGTTGTCTAAAGTTGCC |
| Suggested primer 2: | CCTCCTCGTCAGAGGACAAC |