| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.149290 |
| Chromosome: | chromosome 11 |
| Location: | 2737311 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477100 | FAP97 | (1 of 1) IPR003882//IPR029488 - Pistil-specific extensin-like protein // KIAA1430 homologue; Flagellar Associated Protein 97 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGGCGTGGTGACGCCAGCATCCAAAG |
| Internal bar code: | TTGTATCGTAAAGCTTTGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 677 |
| LEAP-Seq percent confirming: | 97.7273 |
| LEAP-Seq n confirming: | 731 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTTTGCGCAATGTTTTCC |
| Suggested primer 2: | GAAGGCAGTTGAGGACAAGC |