Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.149310 |
Chromosome: | chromosome 3 |
Location: | 2537567 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g160150 | (1 of 35) IPR016135 - Ubiquitin-conjugating enzyme/RWD-like | CDS/intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCGCTCCCACCAACATCATTCCTGCAT |
Internal bar code: | CTACCCGCCATCAATTCAGCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 419 |
LEAP-Seq percent confirming: | 75.4116 |
LEAP-Seq n confirming: | 687 |
LEAP-Seq n nonconfirming: | 224 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAATCTATGTCGAAACGGCG |
Suggested primer 2: | CTTGAGATAACGGCTGCACA |