Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.149428 |
Chromosome: | chromosome 7 |
Location: | 4150496 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g342550 | SMM28 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) PTHR10108:SF827 - METHYLTRANSFERASE-LIKE PROTEIN-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAAGGCTGAAACCAAAATAAGGAGACAA |
Internal bar code: | CAGACTAACAGGGTGGGGCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 744 |
LEAP-Seq percent confirming: | 98.1583 |
LEAP-Seq n confirming: | 30912 |
LEAP-Seq n nonconfirming: | 580 |
LEAP-Seq n unique pos: | 101 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTGGGAAATCGTCATCAT |
Suggested primer 2: | TACTGCCGCTGCTACTGCTA |