Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.149454 |
Chromosome: | chromosome 2 |
Location: | 6335310 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g115200 | RPL27A,RPL27a | Ribosomal protein L27a, component of cytosolic 80S ribosome and | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATTCCATAGCCAGGCCACAGCAGCTCT |
Internal bar code: | GCACGGGGGGCAGCCTCCCTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 333 |
LEAP-Seq percent confirming: | 99.6596 |
LEAP-Seq n confirming: | 3513 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTGTGTGCAATGGTTCAA |
Suggested primer 2: | TTGATGCAGAGCAACAGACC |