| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149454 |
| Chromosome: | chromosome 2 |
| Location: | 6335323 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115200 | RPL27A,RPL27a | Ribosomal protein L27a, component of cytosolic 80S ribosome and | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAACAGCCGCTGTTCGCGTATAAACTGA |
| Internal bar code: | AAGGGTCTAATTGGCTGTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 741 |
| LEAP-Seq percent confirming: | 99.7552 |
| LEAP-Seq n confirming: | 815 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGTGTGCAATGGTTCAA |
| Suggested primer 2: | TTGATGCAGAGCAACAGACC |