| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149461 |
| Chromosome: | chromosome 16 |
| Location: | 3560814 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g680232 | (1 of 1) PTHR12509:SF8 - SPERMATOGENESIS-ASSOCIATED PROTEIN 4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGCTCCGCATACACATGGGCGTAGGAA |
| Internal bar code: | TCAGCCGTTCCAAGGACGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 485 |
| LEAP-Seq percent confirming: | 89.4482 |
| LEAP-Seq n confirming: | 3323 |
| LEAP-Seq n nonconfirming: | 392 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATGTAAATGACACGCAG |
| Suggested primer 2: | TTACCTTCATTCACAGCCCC |