| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149470 |
| Chromosome: | chromosome 6 |
| Location: | 2105084 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265150 | (1 of 1) K11833 - ubiquitin carboxyl-terminal hydrolase 2/21 [EC:3.4.19.12] (USP2_21) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGCCTGGTAGCGCGCACACACAGTAC |
| Internal bar code: | TGGTCACACCAGGCGCGAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 839 |
| LEAP-Seq percent confirming: | 60.8939 |
| LEAP-Seq n confirming: | 1417 |
| LEAP-Seq n nonconfirming: | 910 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGGCTTCATTCTGCTTT |
| Suggested primer 2: | CATGAGTCACTGTGGGGTTG |