Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.149486 |
Chromosome: | chromosome 11 |
Location: | 1726006 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467785 | (1 of 3) PTHR10625:SF102 - HISTONE DEACETYLASE 10 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCGCTCGCGTCCAAGCCAATTACAAACA |
Internal bar code: | GCGGTGACGACTGCCCTAGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 278 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTACCGGTATGGTGGTG |
Suggested primer 2: | AGGTATCTCATGGGCTGGTG |