| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149558 |
| Chromosome: | chromosome 7 |
| Location: | 5061058 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g347550 | (1 of 1) PTHR23389:SF6 - ATPASE FAMILY AAA DOMAIN-CONTAINING PROTEIN 5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAAAGCGCGACAGCAGCGGCCCTTGGG |
| Internal bar code: | GTACGGTCTGGGTCCGCACTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 313 |
| LEAP-Seq percent confirming: | 57.1335 |
| LEAP-Seq n confirming: | 5222 |
| LEAP-Seq n nonconfirming: | 3918 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCACAGCTGTTGTGTACGG |
| Suggested primer 2: | ACCTTCGCCATCAATACTGG |