| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149587 |
| Chromosome: | chromosome 2 |
| Location: | 1519726 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g084350 | CGLD1,PAM71 | (1 of 1) PTHR12608:SF6 - GDT1-LIKE PROTEIN 1, CHLOROPLASTIC; Mn transport across thylakoid membrane | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTCCGATCTCGATTTTGTTCCGGCCTCC |
| Internal bar code: | GGGCAATCCTGCAGACGGACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 375 |
| LEAP-Seq percent confirming: | 95.4526 |
| LEAP-Seq n confirming: | 2246 |
| LEAP-Seq n nonconfirming: | 107 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGCATGGTAGGGAAGAT |
| Suggested primer 2: | TACATTGGCGGCTCTCTCTT |