Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.149643 |
Chromosome: | chromosome 3 |
Location: | 567947 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g145447 | TTLL3,TTLL8 | Tubulin monoglycylase; (1 of 1) K16608 - tubulin monoglycylase TTLL3/8 [EC:6.3.2.-] (TTLL3_8) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGCACGTTGCAATTATAGCTTGGCGC |
Internal bar code: | ACTAGGAAAGAGGGATGCGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 274 |
LEAP-Seq percent confirming: | 85.0683 |
LEAP-Seq n confirming: | 997 |
LEAP-Seq n nonconfirming: | 175 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGAGAGACTGGATGGTTCC |
Suggested primer 2: | ACTTGCAGAGGAAGAAGGCA |