Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.149673 |
Chromosome: | chromosome 3 |
Location: | 8199867 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g200100 | PUX10 | Plant UBX domain-containing protein 10; (1 of 1) K18726 - FAS-associated factor 2 (FAF2, UBXD8) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCATGTGTGCTGTTGGGAAACGCCTAATG |
Internal bar code: | GAATGGGAAAAGGAGGGGATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 127 |
LEAP-Seq percent confirming: | 93.7126 |
LEAP-Seq n confirming: | 1565 |
LEAP-Seq n nonconfirming: | 105 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCTGTTGGCAGAGGAAAC |
Suggested primer 2: | GTGAGGGTTTGAAGCAGAGC |