| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.149689 |
| Chromosome: | chromosome 3 |
| Location: | 8322347 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g199000 | PHOT,PHT1,PHOT1 | (1 of 1) PTHR24351//PTHR24351:SF76 - RIBOSOMAL PROTEIN S6 KINASE // PROTEIN TWIN LOV 1; Phototropin 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATTAACTAAATGCTTAGGGTTGGTGTGAA |
| Internal bar code: | TGTTCGTAAAATACAGCGCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 539 |
| LEAP-Seq percent confirming: | 99.9236 |
| LEAP-Seq n confirming: | 2615 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCGTTACACCGGACAAT |
| Suggested primer 2: | AAGATGCTACTGATGCCGCT |