| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149705 |
| Chromosome: | chromosome 8 |
| Location: | 823344 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g360850 | (1 of 1) K18798 - protein AFG1 (AFG1, LACE1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTCCGGCCACACCCACCGCACCGCTCT |
| Internal bar code: | GGGGTACGTGGAGTGCGATAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 793 |
| LEAP-Seq percent confirming: | 51.8395 |
| LEAP-Seq n confirming: | 620 |
| LEAP-Seq n nonconfirming: | 576 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCAGCAGGAGAGAAGGGA |
| Suggested primer 2: | ACGGTCCATGATATCCCAAA |