| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.149707 |
| Chromosome: | chromosome 16 |
| Location: | 1050591 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649433 | (1 of 4) IPR000104//IPR001471//IPR016177 - Antifreeze protein, type I // AP2/ERF domain // DNA-binding domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCTGCATAGTACGATGCATTGCATCAG |
| Internal bar code: | GTCATTGGGATTTAAGGAGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 588 |
| LEAP-Seq percent confirming: | 98.9421 |
| LEAP-Seq n confirming: | 12065 |
| LEAP-Seq n nonconfirming: | 129 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTGTGGGCCGTTTATTTT |
| Suggested primer 2: | TCATCATGTCAGCTTGCCTC |