Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.149722 |
Chromosome: | chromosome 11 |
Location: | 1284791 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467708 | (1 of 1) IPR029022 - ABC transporter, BtuC-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGGTCCTGTCCCCCTCCGACTCCACGCT |
Internal bar code: | CTATACAGCGGGGCGGTACGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 645 |
LEAP-Seq percent confirming: | 58.5377 |
LEAP-Seq n confirming: | 7710 |
LEAP-Seq n nonconfirming: | 5461 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGACGTTCGTGAAGTTCGAG |
Suggested primer 2: | TCGTTCCTCTCTTCCCTCAA |