| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149724 |
| Chromosome: | chromosome 7 |
| Location: | 2022680 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325761 | (1 of 2) IPR000104//IPR003439//IPR003593//IPR011527//IPR027417 - Antifreeze protein, type I // ABC transporter-like // AAA+ ATPase domain // ABC transporter type 1, transmembrane domain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACGGCATGTGTGTACGGCATATGTGTG |
| Internal bar code: | ACAGGGGGGCGGACAGGACCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 86 |
| LEAP-Seq percent confirming: | 98.1308 |
| LEAP-Seq n confirming: | 210 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCATCTCACCTCCCAGCTC |
| Suggested primer 2: | ATAATGCTTATGGGAGGGGG |