| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149741 |
| Chromosome: | chromosome 17 |
| Location: | 3006994 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720400 | HMA1 | (1 of 1) PTHR24093:SF272 - CADMIUM/ZINC-TRANSPORTING ATPASE HMA1, CHLOROPLASTIC-RELATED; heavy metal transporting ATPase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAATGCCCCGCAGCGCCTATCCGGTGGCG |
| Internal bar code: | CATACCGTCACACCAGATGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 582 |
| LEAP-Seq percent confirming: | 99.5537 |
| LEAP-Seq n confirming: | 2454 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAGTAACGGTCGGTTCGT |
| Suggested primer 2: | GAAGTACGGCTTCACAAGGC |