| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.149769 |
| Chromosome: | chromosome 3 |
| Location: | 2281932 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158050 | PPP11 | (1 of 1) PF00686//PF07228 - Starch binding domain (CBM_20) // Stage II sporulation protein E (SpoIIE) (SpoIIE); Phosphoprotein phosphatase 2C-related | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGACATGGGACGGTGCCGGAGTGCCA |
| Internal bar code: | ATTCGTTCTTTCTCTACTGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 381 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 312 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTCGATCTCATCGTCAA |
| Suggested primer 2: | GTGGGGGTTCCTTGGATACT |