| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149791 |
| Chromosome: | chromosome 8 |
| Location: | 3210784 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g373450 | SBE4 | (1 of 1) 3.2.1.141 - 4-alpha-D-((1->4)-alpha-D-glucano)trehalose trehalohydrolase / Maltooligosyl trehalose trehalohydrolase; Starch Branching Enzyme 4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTAATCCTGGTGGGAGCCTTGCGGCGCA |
| Internal bar code: | ATGAGCCGATATGCGGGCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1104 |
| LEAP-Seq percent confirming: | 98.1205 |
| LEAP-Seq n confirming: | 2036 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCCAGAGGAGAGAAGTGT |
| Suggested primer 2: | TCACTCTTGGTCCGAGTCCT |