| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.149798 |
| Chromosome: | chromosome 9 |
| Location: | 6996468 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410900 | NAR2,NIT8 | nitrite transporter accessory protein; (1 of 1) PF16974 - High-affinity nitrate transporter accessory (NAR2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGCGACCGCCGCAACGGTGCCACCAACT |
| Internal bar code: | GCTAGCTGGGTCTGGATCTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 513 |
| LEAP-Seq percent confirming: | 99.2584 |
| LEAP-Seq n confirming: | 13117 |
| LEAP-Seq n nonconfirming: | 98 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCACCCTGTTCACACGTA |
| Suggested primer 2: | TGAAGTAGTGTCGCTGCCTG |