Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.149798 |
Chromosome: | chromosome 9 |
Location: | 6996468 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g410900 | NAR2,NIT8 | nitrite transporter accessory protein; (1 of 1) PF16974 - High-affinity nitrate transporter accessory (NAR2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGCGACCGCCGCAACGGTGCCACCAACT |
Internal bar code: | GCTAGCTGGGTCTGGATCTCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 513 |
LEAP-Seq percent confirming: | 99.2584 |
LEAP-Seq n confirming: | 13117 |
LEAP-Seq n nonconfirming: | 98 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCACCCTGTTCACACGTA |
Suggested primer 2: | TGAAGTAGTGTCGCTGCCTG |