| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149883 |
| Chromosome: | chromosome 6 |
| Location: | 6863195 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g295400 | MITC11,MCP11 | Mitochondrial substrate carrier protein; (1 of 1) PTHR24089//PTHR24089:SF223 - FAMILY NOT NAMED // MITOCHONDRIAL SUBSTRATE CARRIER FAMILY PROTEIN G | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTTAACGCTTTCTGTCAAGGGCTGGGAA |
| Internal bar code: | CTTTGAGAACTAGTCCGCGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1038 |
| LEAP-Seq percent confirming: | 99.4236 |
| LEAP-Seq n confirming: | 690 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTGTATCGGGTGGTGAGC |
| Suggested primer 2: | CCTCGGGTTACCGTTAGTCA |