| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.149904 |
| Chromosome: | chromosome 17 |
| Location: | 711544 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g701000 | (1 of 1) PTHR35518//PTHR35518:SF2 - FAMILY NOT NAMED // MAINTENANCE OF TELOMERE CAPPING PROTEIN 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCACCCCGCCCCACACACCCACACCTAC |
| Internal bar code: | GCATAAGGCGGAAGATGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 289 |
| LEAP-Seq percent confirming: | 87.7243 |
| LEAP-Seq n confirming: | 1222 |
| LEAP-Seq n nonconfirming: | 171 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCTCCCTCCCTCTTCCTC |
| Suggested primer 2: | TACGGTAATCCGTTGCTGTG |