| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.149973 |
| Chromosome: | chromosome 12 |
| Location: | 5438643 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g530350 | CrZIP12,ZIP10,IRT2 | Iron-nutrition responsive ZIP family Fe transporter; (1 of 5) K07238 - zinc transporter, ZIP family (TC.ZIP, zupT, ZRT3, ZIP2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCTCAGGCCGAAACGAGAAGTTTTCGGG |
| Internal bar code: | AGGGCAAATCACGCCGGCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 911 |
| LEAP-Seq percent confirming: | 98.583 |
| LEAP-Seq n confirming: | 974 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATACTGATGCCAGGAGGT |
| Suggested primer 2: | CATGTCTGCAGTAAAGGCGA |