| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.150000 |
| Chromosome: | chromosome 9 |
| Location: | 2753550 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389250 | AOF1 | (1 of 2) 1.5.3.17 - Non-specific polyamine oxidase / Polyamine oxidase; Amine oxidase, flavin-containing | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCACAGTGTCGCCGTCATTGGCGCCGGCC |
| Internal bar code: | TTGCAGCGAATCCCAGACTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 565 |
| LEAP-Seq percent confirming: | 99.7242 |
| LEAP-Seq n confirming: | 3254 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAAGGCGAAAGACGAAGA |
| Suggested primer 2: | CTCCTCTCGCTCACCTTGTC |