| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.150012 |
| Chromosome: | chromosome 5 |
| Location: | 2206395 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234654 | (1 of 1) IPR002110//IPR003613//IPR013083//IPR020683 - Ankyrin repeat // U box domain // Zinc finger, RING/FYVE/PHD-type // Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGGGACCATCCGGGCCGGTTGCGTGT |
| Internal bar code: | GCCGACACAAGAGCCGCAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 961 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 116 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGTACTGCTGAAACCAAC |
| Suggested primer 2: | GCGGAACTAGGTGTGGATGT |