Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.150019 |
Chromosome: | chromosome 7 |
Location: | 4266657 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g341700 | (1 of 1) K08866 - serine/threonine-protein kinase TTK/MPS1 (TTK, MPS1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATATGTGTCGTACATGCACGGAAGCGGT |
Internal bar code: | GGGGCGCCTAACGTTCGACCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 247 |
LEAP-Seq percent confirming: | 92.581 |
LEAP-Seq n confirming: | 1485 |
LEAP-Seq n nonconfirming: | 119 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTGGTGCAGTGATTGGTT |
Suggested primer 2: | TGTCTGCTCTTTCCACATGC |