| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.150025 |
| Chromosome: | chromosome 6 |
| Location: | 3317009 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g277350 | HDA13 | RPD3/HDA1 type histone deacetylase; (1 of 4) K06067 - histone deacetylase 1/2 (HDAC1_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGGGAAGGGCCCGCACCCCCACCACCTG |
| Internal bar code: | AGGTGCAATGGAGCGCGTCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 473 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 198 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTACGGTAGCTGGGTTTGG |
| Suggested primer 2: | CAGTCGCACAAATAGCCTCA |