| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.150071 |
| Chromosome: | chromosome 6 |
| Location: | 8478843 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307650 | (1 of 1) PF12138 - Spherulation-specific family 4 (Spherulin4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGGACAGTGGACAGTGGACAGAATCTGA |
| Internal bar code: | TGGGTTAGAGAGCTTCAGATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 513 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 112 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTCCGGCCTATACACACA |
| Suggested primer 2: | GCATCCTTGAGCTGCCTTAC |