Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.150106 |
Chromosome: | chromosome 9 |
Location: | 3651736 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390467 | CGL66 | (1 of 3) PTHR12385:SF44 - PLASMA-MEMBRANE CHOLINE TRANSPORTER FAMILY PROTEIN; Conserved in the Green Lineage | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAGTGCTGGGGCCCAAACTCCGGAAGTT |
Internal bar code: | AAGTGGTTGTCAAGTCAAAATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 463 |
LEAP-Seq percent confirming: | 98.374 |
LEAP-Seq n confirming: | 605 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGTAACGTGGTCAAGGGA |
Suggested primer 2: | ATTTCCATCCCAGTGAGTGC |