| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.150118 |
| Chromosome: | chromosome 11 |
| Location: | 1513943 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467747 | (1 of 2) PF10173 - Mitochondrial K+-H+ exchange-related (Mit_KHE1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGCTAGCCCGTGCGTTGCTAGCCCTGG |
| Internal bar code: | TCCGTGGGCCCACTTCTGGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 468 |
| LEAP-Seq percent confirming: | 99.2771 |
| LEAP-Seq n confirming: | 412 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGTTAAAAGGCATACCG |
| Suggested primer 2: | TCGGTGATTTAAAGCCTTGG |