| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.150149 |
| Chromosome: | chromosome 1 |
| Location: | 7905112 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g063997 | (1 of 1) PF06741//PF14438 - LsmAD domain (LsmAD) // Ataxin 2 SM domain (SM-ATX) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCCCGCCGCCGCCGCCGTACCCGCCGC |
| Internal bar code: | CGAGCCCGAAATAGTACGGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 58 |
| LEAP-Seq percent confirming: | 99.3902 |
| LEAP-Seq n confirming: | 163 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGCGGATCTCAAGAAGTC |
| Suggested primer 2: | CATCTGCGCCATGTAGTGC |