Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.150170 |
Chromosome: | chromosome 5 |
Location: | 2128778 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g234640 | (1 of 1) IPR000048//IPR011989//IPR016024 - IQ motif, EF-hand binding site // Armadillo-like helical // Armadillo-type fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCACACACGCCCCCCCCCCCTCTTCCCA |
Internal bar code: | CCTCCCATGGGCAGCAGCCCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 113 |
LEAP-Seq percent confirming: | 98.324 |
LEAP-Seq n confirming: | 176 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGCCAGTCCAACCTGAAC |
Suggested primer 2: | CTCCTTGAACCCCTTGAACA |