Insertion junction: LMJ.RY0402.150269_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.150269
Chromosome:chromosome_4
Location:1933325
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre04.g218250 ARL3 ARF-like GTPase antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AAGGGGGCCGTCCAGCCGGCCGCGGTGCCG
Internal bar code:GAGGCCGGGCGGTAAGCCTTGC

Confirmation - LEAP-Seq

LEAP-Seq distance:230
LEAP-Seq percent confirming:99.7908
LEAP-Seq n confirming:11449
LEAP-Seq n nonconfirming:24
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:ATGAGTTCGGGTGTAGGTGC
Suggested primer 2:TGCTATCAGACATGGCTTGC