Insertion junction: LMJ.RY0402.150269_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.150269
Chromosome:chromosome_4
Location:1933610
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre04.g218250 ARL3 ARF-like GTPase antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AGCTGCATCCCCCTTGCAGCCCCACGCCGC
Internal bar code:AATTGTTGATTAGCAATAGAAG

Confirmation - LEAP-Seq

LEAP-Seq distance:150
LEAP-Seq percent confirming:81.7343
LEAP-Seq n confirming:443
LEAP-Seq n nonconfirming:99
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:CAGTGGTGCATGGGTGTAAG
Suggested primer 2:TCAGGAAAGAATGGTGGGAG