| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.150275 |
| Chromosome: | chromosome 9 |
| Location: | 7735864 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g416100 | DNJ11 | (1 of 1) K09518 - DnaJ homolog subfamily B member 12 (DNAJB12); DnaJ-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCATCACCTGCGCAAGACTACTGACGA |
| Internal bar code: | CGCAGCCCTTGTGGGGGCACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 795 |
| LEAP-Seq percent confirming: | 99.8177 |
| LEAP-Seq n confirming: | 3832 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCTCTACAAGGGCAACG |
| Suggested primer 2: | TTGTTTTGTTGTGCGATGGT |