| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.150360 |
| Chromosome: | chromosome 5 |
| Location: | 2629748 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236350 | (1 of 41) PTHR10157 - DOPAMINE BETA HYDROXYLASE RELATED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATCGGCCACAACACCGCGCCTCTGTAA |
| Internal bar code: | TACCACTCTTGGTCGGCGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 103 |
| LEAP-Seq percent confirming: | 61.5385 |
| LEAP-Seq n confirming: | 96 |
| LEAP-Seq n nonconfirming: | 60 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTTTTGGTTGCATCGGTA |
| Suggested primer 2: | CCATTCTCTTTTGCCTCTGC |