| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.150530 |
| Chromosome: | chromosome 10 |
| Location: | 3699663 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g446100 | TRX6,TRXY,TRXY1 | Thioredoxin y, chloroplastic; (1 of 1) PTHR10438:SF280 - THIOREDOXIN Y1, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGGGCCGCTGACGCCGTGCTGTTGCCT |
| Internal bar code: | AGTGTTCGTGAGGAAGCTCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 949 |
| LEAP-Seq percent confirming: | 99.6767 |
| LEAP-Seq n confirming: | 7708 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTGCAGACCAAGATGAA |
| Suggested primer 2: | GTTGATTACGCCGGAACAGT |