| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.150592 |
| Chromosome: | chromosome 9 |
| Location: | 5263762 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399663 | FXL7,FXL4 | FixL-like PAS domain protein; (1 of 11) PF13426 - PAS domain (PAS_9) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATACCGCCGTCCTGGCTGTCCTTGAGCT |
| Internal bar code: | TGTTAGACTATGTTCGTAGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 721 |
| LEAP-Seq percent confirming: | 99.0566 |
| LEAP-Seq n confirming: | 840 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCACACCATCCTTGCACAC |
| Suggested primer 2: | TTGGGCTTGGTTTAGTTTGG |