Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.150600 |
Chromosome: | chromosome 7 |
Location: | 103683 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g312900 | (1 of 1) K10590 - E3 ubiquitin-protein ligase TRIP12 (TRIP12) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAGGAGCGCCATGGACGAGGACAAGGTG |
Internal bar code: | ACATCTGCTCTCGATCTGACTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 970 |
LEAP-Seq percent confirming: | 99.6765 |
LEAP-Seq n confirming: | 6470 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCAGAAACCAGCATGCAA |
Suggested primer 2: | CACCGCTGCTTATCAGTTCA |