| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.150704 |
| Chromosome: | chromosome 6 |
| Location: | 8403116 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g306950 | STPK15,STK15 | Serine/threonine protein kinase; (1 of 1) K08789//K12767 - microtubule-associated serine/threonine kinase [EC:2.7.11.1] (MAST) // serine/threonine-protein kinase RIM15 (RIM15) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTCAAAGATCTCCTCCGGCGTCTCGGC |
| Internal bar code: | CCCGTCCAAGTTTAGGGGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 59 |
| LEAP-Seq percent confirming: | 98.0769 |
| LEAP-Seq n confirming: | 51 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTGTATCCCTTTTGCCT |
| Suggested primer 2: | ACGTGAAGCTGACGGACTTT |